View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20122_low_18 (Length: 252)
Name: NF20122_low_18
Description: NF20122
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20122_low_18 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 18 - 222
Target Start/End: Complemental strand, 23377038 - 23376833
Alignment:
| Q |
18 |
atgtttatacacggaggtaattctcaccatttataagatttactttaacatgtcattgcctaatatttacgaagttacannnnnnnnn-aatcctaatca |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||| || |
|
|
| T |
23377038 |
atgtttatacacggaggtaattctcaccatttataagatttactttaacatgtcattgcctaatatttacgaagttaaattttttttttaatcctaaaca |
23376939 |
T |
 |
| Q |
117 |
aatttccaaaacttcatgcatatcacttttggtcattttttcagctatccaatttttcaaactctcaaggaattaaccaagatttctttcctaacaagaa |
216 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
23376938 |
aatttccaaaacttcatgcatattacttttggtcattttttcagctatccaatttttcaaactctaaaggaattaaccaatatttctttcctaacaagaa |
23376839 |
T |
 |
| Q |
217 |
attttt |
222 |
Q |
| |
|
|||||| |
|
|
| T |
23376838 |
attttt |
23376833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University