View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20122_low_19 (Length: 244)
Name: NF20122_low_19
Description: NF20122
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20122_low_19 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 124; Significance: 7e-64; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 124; E-Value: 7e-64
Query Start/End: Original strand, 26 - 225
Target Start/End: Original strand, 27008184 - 27008379
Alignment:
| Q |
26 |
attctttagcaataaatattatcaatggtactttagaaaatacacannnnnnnnnnnnnataaaatcagaaagatcaattagactagacaaatannnnnn |
125 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
27008184 |
attctttagcaataaatattatcaatggaactttagaaaatacacattttttttt----ataaaatcagaaagatcaattagactagacaaatatttttt |
27008279 |
T |
 |
| Q |
126 |
nnaataagtgcaaggttgattacttttactttaaattgagaccatacttgattatttagagaatatattctatgactaatatgatcacacgtaccccatg |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
27008280 |
taaataagtgcaaggttgattacttttactttaaattgagaccatacttgattatttagagaatatattgtatgactaatatgatcacacgtaccccatg |
27008379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University