View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20124_high_7 (Length: 281)
Name: NF20124_high_7
Description: NF20124
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20124_high_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 171; Significance: 7e-92; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 171; E-Value: 7e-92
Query Start/End: Original strand, 84 - 265
Target Start/End: Complemental strand, 38944788 - 38944609
Alignment:
| Q |
84 |
ccaatacttgaaataatggctacatatataacatctattatctattgctattacatgtctctcactcactcacaggctacatacatatctccaacttata |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38944788 |
ccaatacttgaaataatggctacatatataacatctattatctattgctatta--tgtctctcactcactcacaggctacatacatatctccaacttata |
38944691 |
T |
 |
| Q |
184 |
gttaactagctagctagatagacatgtgcacgcacgcatgtcaaactcaatcctatgattcatatcaaacattcaatgtaag |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38944690 |
gttaactagctagctagatagacatgtgcacgcacgcatgtcaaactcaatcctatgattcatatcaaacattcaatgtaag |
38944609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University