View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20124_low_8 (Length: 303)
Name: NF20124_low_8
Description: NF20124
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20124_low_8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 247; Significance: 1e-137; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 42 - 292
Target Start/End: Original strand, 43895931 - 43896181
Alignment:
| Q |
42 |
aggttatcagatgtactttgtcaacaaagttttgcatgagcttatacaaaatctatttgtaagttttgcacgaacttgttataatatatgggcatagcta |
141 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43895931 |
aggttatcagatgtactttgtcaacaaagttttgcatgagcttatacaaaatctacttgtaagttttgcacgaacttgttataatatatgggcatagcta |
43896030 |
T |
|
| Q |
142 |
tcatgttttgataagaacataatttatctttacaaaatcaacttattagtcggaggtcttctttataaattaactattttaagtttttatgtcaaactcg |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43896031 |
tcatgttttgataagaacataatttatctttacaaaatcaacttattagtcggaggtcttctttataaattaactattttaagtttttatgtcaaactcg |
43896130 |
T |
|
| Q |
242 |
tgtttctttgatcacatctaaactaactgttgagttttataccatattcat |
292 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43896131 |
tgtttctttgatcacatctaaactaactgttgagttttataccatattcat |
43896181 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 46 - 86
Target Start/End: Original strand, 43907466 - 43907506
Alignment:
| Q |
46 |
tatcagatgtactttgtcaacaaagttttgcatgagcttat |
86 |
Q |
| |
|
|||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
43907466 |
tatcagatgtacttcgacaacaaagttttgcatgagcttat |
43907506 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University