View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20125_low_14 (Length: 378)
Name: NF20125_low_14
Description: NF20125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20125_low_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 154; Significance: 1e-81; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 208 - 365
Target Start/End: Complemental strand, 32483534 - 32483377
Alignment:
| Q |
208 |
gctgatagatatgaaatatggtggagattttaagcttgaacataaacacacgcaatcgatacggttggattgttagcagatatagttccaaaactatgtc |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32483534 |
gctgatagatatgaaatatggtggagattttaagcttgaacataaacacacgcaatcgatacggttggattgttagcagatatagttccaaaactatgtc |
32483435 |
T |
 |
| Q |
308 |
atcagtatttggctatctttttcagagaattcctctaaaccaaaagattctccctttg |
365 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
32483434 |
atcagtatttggctatctttttcagagaattcctctaaaccaaaagattctctctttg |
32483377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 131; E-Value: 7e-68
Query Start/End: Original strand, 18 - 148
Target Start/End: Complemental strand, 32483732 - 32483602
Alignment:
| Q |
18 |
aaaatgatggtagctagtgattgaggtgagaatatgtgtggatgtgaaagagagagggaatgtgctaagaaagaggaggaaaaacagtttctttcttggt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32483732 |
aaaatgatggtagctagtgattgaggtgagaatatgtgtggatgtgaaagagagagggaatgtgctaagaaagaggaggaaaaacagtttctttcttggt |
32483633 |
T |
 |
| Q |
118 |
cagggctactaaataacagtgatgtttttca |
148 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
32483632 |
cagggctactaaataacagtgatgtttttca |
32483602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University