View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20125_low_15 (Length: 350)
Name: NF20125_low_15
Description: NF20125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20125_low_15 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 15 - 227
Target Start/End: Original strand, 38051750 - 38051959
Alignment:
| Q |
15 |
acatatttcaataattaacaatatctcattgcattgtatctatattattttacttttgcagaagcaaagaaagaagaattcacagaaatttatcatggta |
114 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38051750 |
acatatttcaataattaaca---tctcattgcattgtatctatattattttacttttgcagaagcaaagaaagaagaattcacagaaatttatcatggta |
38051846 |
T |
 |
| Q |
115 |
gagataaccgaagaaatcgagtcctttgatcaacaaaaagaagaagaaatcgattatgacgagctgaagaagcgcatgtggaaggaccgaatcctactac |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38051847 |
gagataaccgaagaaatcgagtcctttgatcaacaaaaagaagaagaaatcgattatgacgagctgaagaagcgcatgtggaaggaccgaatcctactac |
38051946 |
T |
 |
| Q |
215 |
agaagctcaaggg |
227 |
Q |
| |
|
||||||||||||| |
|
|
| T |
38051947 |
agaagctcaaggg |
38051959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 293 - 330
Target Start/End: Original strand, 38052025 - 38052062
Alignment:
| Q |
293 |
tgtcaagagcacaagattcaattctcaaatacatgatg |
330 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38052025 |
tgtcaagagcacaagattcaattctcaaatacatgatg |
38052062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University