View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20127_low_11 (Length: 343)
Name: NF20127_low_11
Description: NF20127
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20127_low_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 80; Significance: 2e-37; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 15 - 102
Target Start/End: Original strand, 39596911 - 39596998
Alignment:
| Q |
15 |
gccggcatcattattgagtggtgcctgaacgagcatggtagagacgaactcagcggcctcattggcctgtgcaagaagcttttggatt |
102 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
39596911 |
gccggcgtcattattgagtggtgcctgaacgagcatggtagagacgaactcagcggcctcattggcctgtgcaagaagcttctggatt |
39596998 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University