View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20127_low_21 (Length: 242)
Name: NF20127_low_21
Description: NF20127
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20127_low_21 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 39731884 - 39731662
Alignment:
| Q |
1 |
aagcattaatcaccactcaaaaactattttgcttagcaagctggtttcaaagaatagcttaattaaattaaagaatgccaaaaggatattctttgtaaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39731884 |
aagcattaatcaccactcaaaaactattttgcttagcaagctggtttcaaagaatagcttaattaaattaaagaatgccaaaaggatattctttgtaaca |
39731785 |
T |
|
| Q |
101 |
atggagtcagacatggtctggaacctactttgctggccaaaacnnnnnnnnnnnnntctagttagcagcagggaaacatattctgaaaattggtaaagca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39731784 |
atggagtcagacatggtctggaacctactttgctggccaaa---caaaaaaaaatatctagttagcagcagggaaacatattctgaaaattggtaaagca |
39731688 |
T |
|
| Q |
201 |
actcaaagattctagacaatacaact |
226 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
39731687 |
actcaaagattctagacaatacaact |
39731662 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 80 - 136
Target Start/End: Original strand, 44246496 - 44246552
Alignment:
| Q |
80 |
aaaaggatattctttgtaacaatggagtcagacatggtctggaacctactttgctgg |
136 |
Q |
| |
|
|||||||||||||||| || |||||||||||||| |||||||||||| |||||||| |
|
|
| T |
44246496 |
aaaaggatattctttgaaatgatggagtcagacattgtctggaacctagtttgctgg |
44246552 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University