View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20127_low_22 (Length: 228)
Name: NF20127_low_22
Description: NF20127
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20127_low_22 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 48 - 215
Target Start/End: Complemental strand, 2982144 - 2981977
Alignment:
| Q |
48 |
tgacagagaagccccttgctgtcactcttctaaataattatgatacaaaacaaaacacatgagagcagcatcttattaggcacacaaaggctcacacata |
147 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2982144 |
tgacagagaagccccttgctgtcactcttctaaataattatgatacaaaacaaaacacatgagagcagcatcttattaggcacacaaaggctcacacata |
2982045 |
T |
 |
| Q |
148 |
atagaaaaaccttataacagagatcaacaaatttctaacgacagtctaggtaatcacgaggtagttat |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
2982044 |
atagaaaaaccttataacagagatcaacaaatttctaacgacagtctaagtaatcacgaggtagttat |
2981977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University