View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20129_high_4 (Length: 295)
Name: NF20129_high_4
Description: NF20129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20129_high_4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 5 - 278
Target Start/End: Original strand, 4228406 - 4228679
Alignment:
| Q |
5 |
gacatcatcagcaacaataatggcatgnnnnnnngcactcacaacaccacttggtgttgcaattgggacattagttgcctcaaatttcaacccttatagt |
104 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4228406 |
gacatcatcagcaacaataatggcatgtttttttgcacttacaacaccacttggtgttgcaattgggacattagttgcctcaaatttcaacccttatagt |
4228505 |
T |
|
| Q |
105 |
ccaggggctcttatcacagaaggtatcttggactctttgtcagctggaattttagtgtacatggctttggtggatttaatagctgctgattttcttagta |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4228506 |
ccaggggctcttatcacagaaggtatcttggactctttgtcagctggaattttagtgtacatggctttggtggatttaatagctgctgattttcttagta |
4228605 |
T |
|
| Q |
205 |
agaaaatgcgttgtagcttaaggcttcagattgtgtccttttgtttgcttttccttggggctggatctatgtcc |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4228606 |
agaaaatgcgttgtagcttaaggcttcagattgtgtccttttgtttgcttttccttggggctggatctatgtcc |
4228679 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 93 - 268
Target Start/End: Complemental strand, 48078882 - 48078707
Alignment:
| Q |
93 |
aacccttatagtccaggggctcttatcacagaaggtatcttggactctttgtcagctggaattttagtgtacatggctttggtggatttaatagctgctg |
192 |
Q |
| |
|
|||||||||||||| || || || || | |||||||| ||||| | ||||||| ||||||||||||||||||||||| || || || ||||| |||| |
|
|
| T |
48078882 |
aacccttatagtcctggtgcactcatagcggaaggtatattggatgcactgtcagcaggaattttagtgtacatggctttagtagacttgatagcagctg |
48078783 |
T |
|
| Q |
193 |
attttcttagtaagaaaatgcgttgtagcttaaggcttcagattgtgtccttttgtttgcttttccttggggctgg |
268 |
Q |
| |
|
|||||||||| || | |||| |||||| ||| ||||| ||| | || || | |||| ||||||||||||| ||||| |
|
|
| T |
48078782 |
attttcttagcaaaagaatgagttgtaactttaggctgcagttagtatcatattgtatgcttttccttggagctgg |
48078707 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University