View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20129_low_5 (Length: 312)
Name: NF20129_low_5
Description: NF20129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20129_low_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 232; Significance: 1e-128; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 60 - 303
Target Start/End: Original strand, 46864347 - 46864590
Alignment:
| Q |
60 |
tttgttttgttattttgttcatacaataaatgctgcttcagtttaaaacagtgttgtcaaatatcagaggtcaaatggcagatttgtagcaagtgccatg |
159 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||| |||||| |
|
|
| T |
46864347 |
tttgttttgttattttgttcatacaataaatgctgcttcagtttaaaacagtgttgtcaaatatcagcgttcaaatggcagatttgtagcaagcgccatg |
46864446 |
T |
|
| Q |
160 |
gccaatttgtgaaggatggcgacgccatggtgttttatggtggctttaaattgcacatttggttttccaccatccatcatcgttaacactggtttaaaat |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46864447 |
gccaatttgtgaaggatggcgacgccatggtgttttatggtggctttaaattgcacatttggttttccaccatccatcatcgttaacactggtttaaaat |
46864546 |
T |
|
| Q |
260 |
taatttaccacttgtctgtatgattagtgattactttatctgtg |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46864547 |
taatttaccacttgtctgtatgattagtgattactttatctgtg |
46864590 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 153 - 195
Target Start/End: Original strand, 32255305 - 32255347
Alignment:
| Q |
153 |
tgccatggccaatttgtgaaggatggcgacgccatggtgtttt |
195 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
32255305 |
tgccatggccaatttgtgatagatagcgacgccatggtgtttt |
32255347 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 165 - 202
Target Start/End: Complemental strand, 40416761 - 40416724
Alignment:
| Q |
165 |
tttgtgaaggatggcgacgccatggtgttttatggtgg |
202 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
40416761 |
tttgtgaaggatggcgacgacatggcgttttatggtgg |
40416724 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 154 - 202
Target Start/End: Original strand, 30750042 - 30750090
Alignment:
| Q |
154 |
gccatggccaatttgtgaaggatggcgacgccatggtgttttatggtgg |
202 |
Q |
| |
|
|||| |||||||||||||| ||||||| ||||||||||| |||||||| |
|
|
| T |
30750042 |
gccacggccaatttgtgaaagatggcggtgccatggtgttctatggtgg |
30750090 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University