View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2012_high_3 (Length: 274)
Name: NF2012_high_3
Description: NF2012
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2012_high_3 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 18 - 270
Target Start/End: Original strand, 22905020 - 22905272
Alignment:
| Q |
18 |
ataaagttctatacttaaaggttttgtccaagattgaggattatgtatttattttcccttatatttccatcagagttgcttcctttagtagtactgcatt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22905020 |
ataaagttctatacttaaaggttttgtccaagattgaggattatgtatttattttcccttatatttccatcagagttgcttcctttagtagtactgcatt |
22905119 |
T |
|
| Q |
118 |
aacttcttatggttctgctgagatttcttgatccgcagtattgtcccttctttttggagaaacagtttcttgtgccgttgttgagtaatgttctttaatg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22905120 |
aacttcttatggttctgctgagatttcttgatccgcagtattgtcccttctttttggagaaacagtttcttgtgccgttgttgagtaatgttctttaatg |
22905219 |
T |
|
| Q |
218 |
tgcaaaattctttggcgttgcctgagagacacctacttttcttcttctctctc |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
22905220 |
tgcaaaattctttggcgttgcctgagagacacctacttttcttcttctttctc |
22905272 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000002; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 79 - 167
Target Start/End: Complemental strand, 17739473 - 17739385
Alignment:
| Q |
79 |
tatttccatcagagttgcttcctttagtagtactgcattaacttcttatggttctgctgagatttcttgatccgcagtattgtcccttc |
167 |
Q |
| |
|
|||| ||| |||||| ||||| |||||||||||||||||||| ||| ||||| ||| | |||||||||| |||||| ||||||||| |
|
|
| T |
17739473 |
tattaccaacagagtcgcttctcttagtagtactgcattaactacttcaagttctactgcgttttcttgatctgcagtagtgtcccttc |
17739385 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 79 - 167
Target Start/End: Complemental strand, 19040793 - 19040705
Alignment:
| Q |
79 |
tatttccatcagagttgcttcctttagtagtactgcattaacttcttatggttctgctgagatttcttgatccgcagtattgtcccttc |
167 |
Q |
| |
|
|||| ||| |||||| ||||| |||||||||||||||||||| ||| ||||| ||| | |||||||||| |||||| ||||||||| |
|
|
| T |
19040793 |
tattaccaacagagtcgcttctcttagtagtactgcattaactacttcaagttctactgcgttttcttgatctgcagtagtgtcccttc |
19040705 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University