View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20132_high_7 (Length: 238)
Name: NF20132_high_7
Description: NF20132
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20132_high_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 201; Significance: 1e-110; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 7 - 220
Target Start/End: Complemental strand, 31528869 - 31528652
Alignment:
| Q |
7 |
aatatggtgagttacaattatcaatattattattcattggcaggttaatagatcttggtcttctttcagaaaatttatgttaaatattttattctttagg |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31528869 |
aatatggtgagttacaattatcaatattattattcattggcaggttaatagatcttggtcttctttcagaaaatttatgttaaatattttattctttagg |
31528770 |
T |
 |
| Q |
107 |
tatgatatatagttaagattttttgctttaaatttgtttaaactgagagagggagcc----tatattaagtgtctaataatatctcgaatatgattatct |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31528769 |
tatgatatatagttaagattttttgctttaaatttgtttaaactgagagagggagcccatatatattaagtgtctaataatatctcgaatatgattatct |
31528670 |
T |
 |
| Q |
203 |
atggtggaaggaacttgt |
220 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
31528669 |
atggtggaaggaacttgt |
31528652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 57 - 150
Target Start/End: Complemental strand, 31498146 - 31498059
Alignment:
| Q |
57 |
gatcttggtcttctttcagaaaatttatgttaaatattttattctttaggtatgatatatagttaagattttttgctttaaatttgtttaaact |
150 |
Q |
| |
|
|||||| ||||| ||||| |||||| |||||||||||||||||||||||||||| | ||||||||||||| |||||||||||||| |||| |
|
|
| T |
31498146 |
gatctttgtcttttttcaaaaaatt-atgttaaatattttattctttaggtatg----acggttaagatttttt-ctttaaatttgtttgaact |
31498059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University