View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20132_low_4 (Length: 346)
Name: NF20132_low_4
Description: NF20132
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20132_low_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 292; Significance: 1e-164; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 292; E-Value: 1e-164
Query Start/End: Original strand, 14 - 329
Target Start/End: Complemental strand, 16846367 - 16846052
Alignment:
| Q |
14 |
gaacgaccaccaacgataatgattctaccgtttggtagaatctgattcgaagcataccaacgactcgaagaaagattctgttgaagctcttcccaatcac |
113 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16846367 |
gaacgaccaccaacgacaatgattctaccgtttggtagaatctgattcgaagcataccaacgactcgaagaaagattctgttgaagctcttcccaatcac |
16846268 |
T |
 |
| Q |
114 |
acgtgttgttatgaggacaaggcgtaaacgttctgagtttggtgtaaccatcgttgaagccaccggtttggattagggttccggtgggagagactgcacc |
213 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
16846267 |
acgtgttgttatgaggacaaggggtaaacgttctgagtttggtgtaaccatcgttgaagccaccggtttggattagggttccggtgggggagactgcacc |
16846168 |
T |
 |
| Q |
214 |
ggaggaacaccaagcgtcggtttgtagggttaaaggacggagggtgttggtggtgatgtcgtagagaatggagtgagctgtgcagtcgagtttgagagcc |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
16846167 |
ggaggaacaccaagcgtcggtttgtagggttaaaggacggagggtgttggtggtgatgtcgtagaggatggagtgagcggtgcagtcgagtttgagagcc |
16846068 |
T |
 |
| Q |
314 |
atgtcatgagggttgt |
329 |
Q |
| |
|
||||| |||||||||| |
|
|
| T |
16846067 |
atgtcgtgagggttgt |
16846052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 161 - 225
Target Start/End: Complemental strand, 52913319 - 52913255
Alignment:
| Q |
161 |
ccatcgttgaagccaccggtttggattagggttccggtgggagagactgcaccggaggaacacca |
225 |
Q |
| |
|
||||||||||| |||||||||||||| || |||||| ||||| ||| | ||||||||||||||| |
|
|
| T |
52913319 |
ccatcgttgaaaccaccggtttggataagagttccgttgggattgacggaaccggaggaacacca |
52913255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University