View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20132_low_9 (Length: 242)
Name: NF20132_low_9
Description: NF20132
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20132_low_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 136; Significance: 5e-71; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 54 - 230
Target Start/End: Original strand, 7899231 - 7899403
Alignment:
| Q |
54 |
acatatcataacataaccaattcaagcaacaaaatcataaaaatacttttcccaatgatggaaattcgtaagcaacaaaaacccatcaaatttagtagta |
153 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
7899231 |
acatatcataacataaccaattcaagcaacaaaatcataaaaatacttttccctattatggaaattcataagcaacaacaacccatcaaatttagtagta |
7899330 |
T |
|
| Q |
154 |
ggttcaaacgtatttgtgtcttctgtggaaccagctagccctggcaaaaatcccatctatcaacatgctgctattca |
230 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| ||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
7899331 |
ggttcaaacgtatttgtgtcttctgtggcacc----agccctggcaaaaatcccatctaccaacatgctgctattca |
7899403 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 105 - 153
Target Start/End: Original strand, 7883740 - 7883787
Alignment:
| Q |
105 |
ccaatgatggaaattcgtaagcaacaaaaacccatcaaatttagtagta |
153 |
Q |
| |
|
|||||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
7883740 |
ccaatgatggaaattcataagcaac-aaaacccatcaaatttagtagta |
7883787 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University