View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20133_high_2 (Length: 267)
Name: NF20133_high_2
Description: NF20133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20133_high_2 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 17 - 252
Target Start/End: Complemental strand, 36117226 - 36116991
Alignment:
| Q |
17 |
cagagactcaatttcctttggttcaactggacatgttgaattctgtttctcttctccacatttggttgctttgttttcttctttagtgatgatggattcg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36117226 |
cagagactcaatttcctttggttcaactggacatgttgaattctgtttctcttctccacatttggttgctttgttttcttctttagtgatgatggattcg |
36117127 |
T |
|
| Q |
117 |
tgtttctgttgagtttccttttgttcatgataatatttttgatttgcaccaagacggaggattgtgagcaagagaatcccggtgagaataagcaccggag |
216 |
Q |
| |
|
||||||||||||||||||||||||| ||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36117126 |
tgtttctgttgagtttccttttgtttatgatgatatttttgatttgcaccaagtcggaggattgtgagcaagagaatcccggtgagaataagcaccggag |
36117027 |
T |
|
| Q |
217 |
agaaaactatcttggagaaaagatgatgaggtaagt |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
36117026 |
agaaaactatcttggagaaaagatgatgaggtaagt |
36116991 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University