View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20135_high_27 (Length: 237)
Name: NF20135_high_27
Description: NF20135
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20135_high_27 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 103; Significance: 2e-51; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 118 - 220
Target Start/End: Complemental strand, 10081542 - 10081440
Alignment:
| Q |
118 |
tttaaacttttgatgaagggcaaagaatgtccaaaaattaccacctttactcaacagagaaccaccctttcctcctttgtcagacattgtcaaaacttgc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10081542 |
tttaaacttttgatgaagggcaaagaatgtccaaaaattaccacctttactcaacagagaaccaccctttcctcctttgtcagacattgtcaaaacttgc |
10081443 |
T |
|
| Q |
218 |
tta |
220 |
Q |
| |
|
||| |
|
|
| T |
10081442 |
tta |
10081440 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 1 - 81
Target Start/End: Complemental strand, 10081660 - 10081580
Alignment:
| Q |
1 |
cccagaatttcccaacatcataagtaaactaaatgatgaaacccaacataacaatctaacaaaaaatatcaaccccaacaa |
81 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10081660 |
cccagaatttcccaacatcataagtaaactaaatgatgaaacccaacataacaatctaacaaaaaatatcaaccccaacaa |
10081580 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University