View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20135_low_19 (Length: 309)
Name: NF20135_low_19
Description: NF20135
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20135_low_19 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 159; Significance: 1e-84; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 10 - 257
Target Start/End: Original strand, 1920897 - 1921150
Alignment:
| Q |
10 |
attgttttagtcaaaagtttaagctcaattattccttatcaattaatctttaactgaagtttattattgatttaaactcaattatttgtttgatcactat |
109 |
Q |
| |
|
||||||||||| |||||||||| ||| ||||| | | ||||||| |||||||| ||||||||||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
1920897 |
attgttttagttaaaagtttaaactcgattatccatgatcaattcatctttaattgaagtttattatccatttaaactcaattatttggttgatcactat |
1920996 |
T |
 |
| Q |
110 |
gcttgtgtcaaacttttgttaattttgaattttatgggtgttgtaaaagtgattactttttgcacaaatcatggtcac------tgacttgtcatgtctt |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||| ||||||||| |||||| |
|
|
| T |
1920997 |
gcttgtgtcaaacttttgttaattttgaattttatgggtgttgtaaaagggattactttttgcacacatcatggtcactataaatgacttgtcctgtctt |
1921096 |
T |
 |
| Q |
204 |
tggtggtaacccgctagcaacatttcaacctatgatgaatgatatgttttgatc |
257 |
Q |
| |
|
||| |||||||||| | |||||||||||||||||||||||||||| |||||||| |
|
|
| T |
1921097 |
tggaggtaacccgcaaacaacatttcaacctatgatgaatgatatattttgatc |
1921150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University