View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20135_low_22 (Length: 292)
Name: NF20135_low_22
Description: NF20135
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20135_low_22 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 105; Significance: 2e-52; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 157 - 277
Target Start/End: Complemental strand, 43955404 - 43955285
Alignment:
| Q |
157 |
cgcccacccctagagataactatttgtgagagcttatgacatttttatcaacttatttctataaattgtccgtgataacttataaaaacttttgaaaatg |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
43955404 |
cgcccacccctagagataactatttgtgagagcttatgacatttttatcagct-atttctataaattgtctgtgataacttataaaaacttttgaaaatg |
43955306 |
T |
 |
| Q |
257 |
atgtatagcttatatgaaaac |
277 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
43955305 |
atgtatagcttatatgaaaac |
43955285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 74 - 121
Target Start/End: Complemental strand, 43955486 - 43955439
Alignment:
| Q |
74 |
gaaccaaattgaactgtttcagtttcagaattgttagtaatgattcaa |
121 |
Q |
| |
|
||||| ||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43955486 |
gaaccgaatcgaactgtttcagtttcagaattgttagtaatgattcaa |
43955439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 28 - 78
Target Start/End: Complemental strand, 43955547 - 43955497
Alignment:
| Q |
28 |
ccaaacgaaataaaattttagtctagttaccgaattgtttcaaatcgaacc |
78 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| |||||||||| ||||| |
|
|
| T |
43955547 |
ccaaacgaaatcaaattttagtttagttaccgaactgtttcaaattgaacc |
43955497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 204 - 245
Target Start/End: Complemental strand, 44348643 - 44348602
Alignment:
| Q |
204 |
tcaacttatttctataaattgtccgtgataacttataaaaac |
245 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
44348643 |
tcaacttatttctataaattctccgtgataacttatgaaaac |
44348602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University