View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20135_low_27 (Length: 275)
Name: NF20135_low_27
Description: NF20135
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20135_low_27 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 237; Significance: 1e-131; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 19 - 267
Target Start/End: Original strand, 14224739 - 14224987
Alignment:
| Q |
19 |
tgcctttcagtattttctctctaacacagttgttcactatacattttaaaaagcgacaactgaaattaaaaagtaaacaaacccttggtatcacgatttt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14224739 |
tgcctttcagtattttctctctaacacagttgttcactatacattttaaaaagcgacagctgaaattaaaaagtaaacaaacccttggtatcacgatttt |
14224838 |
T |
|
| Q |
119 |
aatttcatcattccttatttagtatcacatgtcttccctagcttatctaggatgagaatattggtgatttccttttgattcaacttgaatatcctctaaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14224839 |
aatttcatcattccttatttagtatcccatgtcttgcctagcttatctaggatgagaatattggtgatttccttttgattcaacttgaatatcctctaaa |
14224938 |
T |
|
| Q |
219 |
aatagaagaaactttatttggaaatttagttaacttctttacctttgct |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14224939 |
aatagaagaaactttatttggaaatttagttaacttctttacctttgct |
14224987 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 171 - 261
Target Start/End: Original strand, 14232103 - 14232194
Alignment:
| Q |
171 |
tgagaatattggtgatttccttttgattcaacttgaatatcctctaaaaatagaagaaactttatttgg-aaatttagttaacttctttacc |
261 |
Q |
| |
|
||||||||| ||||||||||||||||||||| |||||||||||||||||||| |||| | ||||||||| |||||||||||||||||||||| |
|
|
| T |
14232103 |
tgagaatatcggtgatttccttttgattcaaattgaatatcctctaaaaataaaagagaatttatttggaaaatttagttaacttctttacc |
14232194 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University