View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20135_low_28 (Length: 274)
Name: NF20135_low_28
Description: NF20135
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20135_low_28 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 124; Significance: 8e-64; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 124; E-Value: 8e-64
Query Start/End: Original strand, 22 - 149
Target Start/End: Original strand, 42481495 - 42481622
Alignment:
| Q |
22 |
tttgacagaatcactggtgattttaaaaatagctacactttatgattcaaaaaatgctttacctgtgccccagctccatagattcttatgtccaagaagg |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42481495 |
tttgacagaatcactggtgattttaaaaatagctacactttatgattcaaaaaatgctttacctgtgccccagctccatagattcttatgtccaagaaga |
42481594 |
T |
|
| Q |
122 |
tatgtcttccctgatgaaaggaaaggaa |
149 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
42481595 |
tatgtcttccctgatgaaaggaaaggaa |
42481622 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 200 - 259
Target Start/End: Original strand, 42481683 - 42481742
Alignment:
| Q |
200 |
gaagatgttttgcaggttaggcattatatgatttcttttatgtcttgttctacctctctg |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42481683 |
gaagatgttttgcaggttaggcattatatgatttcttttatgtcttgttctacctctctg |
42481742 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University