View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20136_high_5 (Length: 233)
Name: NF20136_high_5
Description: NF20136
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20136_high_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 18 - 218
Target Start/End: Complemental strand, 35749292 - 35749092
Alignment:
| Q |
18 |
atgaatttggaagtatgcatgatatattattactcacacaactgatgttgtaacaagctttagcttttattcttattccagagggggatagcatattcaa |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
35749292 |
atgaatttggaagtatgcatgatatattattactcacacaactgatgttgtaacaagctttagcttttattcttattccagagggggatagcacattcaa |
35749193 |
T |
 |
| Q |
118 |
ttttttactgcttcacaaattcataatggttatgtgagccatcaacatcaggagactcttcactaggttgttccttgtgtgggtgttgtgtgcaataaaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35749192 |
ttttttactgcttcacaaattcataatggttatgtgagccatcaacatcaggagactcttcactaggttgttccttgtgtgggtgttgtgtgcaataaaa |
35749093 |
T |
 |
| Q |
218 |
c |
218 |
Q |
| |
|
| |
|
|
| T |
35749092 |
c |
35749092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University