View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20137_high_9 (Length: 325)
Name: NF20137_high_9
Description: NF20137
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20137_high_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 291; Significance: 1e-163; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 291; E-Value: 1e-163
Query Start/End: Original strand, 1 - 307
Target Start/End: Complemental strand, 294791 - 294485
Alignment:
| Q |
1 |
tgttgaggaggaaaagagaggaagatccaaggcaacaaggttggaacccaaatctaaggataaagttattctaaaaaaggtatgcatcattaaccccttt |
100 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
294791 |
tgttgaggaggacaagagaggaagatccaaggcaacaaggttggaacccaaatctaaggataaagttattctaaaaaaggtatgcatcattaacccctta |
294692 |
T |
 |
| Q |
101 |
cttgttgtctaaataaaattgaattttagtataaggtaggattctgcaatgtgaatgctcagagcaaccaaaacaggctatagcacagaccgacacctcg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||| |
|
|
| T |
294691 |
cttgttgtctaaataaaattgaattttagtataaggtaggattctgcaatgtgaatgctcagagcaaccaaaataggctatagcacagactgacacctcg |
294592 |
T |
 |
| Q |
201 |
gattgaagatgtgtccgcggcttggcatgacacatgtgattacattcaattatttggccacgacacatgtccggcttgttaacgttggtgtagtgtctct |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
294591 |
gattgaagatgtgtccgcggcttggcatgacacatgtgattacattcaattatttggccacgacacatgtccggcttgttaacgttggtgtagtgtctct |
294492 |
T |
 |
| Q |
301 |
taaaatt |
307 |
Q |
| |
|
||||||| |
|
|
| T |
294491 |
taaaatt |
294485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University