View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20137_low_21 (Length: 214)
Name: NF20137_low_21
Description: NF20137
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20137_low_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 87; Significance: 7e-42; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 95 - 185
Target Start/End: Complemental strand, 48610222 - 48610132
Alignment:
| Q |
95 |
caatgagttgcaccgtctactctactatcatgtggtcagttagttagaatgaatgaatagattgctttgtgcctttcttgttggcagtgaa |
185 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48610222 |
caatgagttgcaccgtctactctacaatcatgtggtcagttagttagaatgaatgaatagattgctttgtgcctttcttgttggcagtgaa |
48610132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 14 - 65
Target Start/End: Complemental strand, 48610262 - 48610211
Alignment:
| Q |
14 |
ataattctatacttgtacaatggatgctgtagaattaatgcaatgagttgca |
65 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
48610262 |
ataattctatacttgtactatggatgctgtagaattaatgcaatgagttgca |
48610211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University