View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20138_high_17 (Length: 208)
Name: NF20138_high_17
Description: NF20138
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20138_high_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 134; Significance: 6e-70; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 16 - 189
Target Start/End: Original strand, 25501577 - 25501753
Alignment:
| Q |
16 |
gcaaaggagaaaaggggagaaaagagttttcgnnnnnnnttataaagtttaccattggagggagactttcattttagaccccaaaattgggcatattaca |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
25501577 |
gcaaaggagaaaaggggagaaaagagttttcgaaaaaaattatagagtttaccattggagggagactttcattttagaccccaaaattgggcatatgaca |
25501676 |
T |
 |
| Q |
116 |
tgataaccccat---caagtccacttggagttgaacagggcgtttagtggccatatcagcagttgagactgtgtcag |
189 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25501677 |
tgataaccccatcaacaagtccacttggagttgaacagggcgtttagtggccatatcagcagttgagactgtgtcag |
25501753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University