View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20138_high_9 (Length: 350)
Name: NF20138_high_9
Description: NF20138
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20138_high_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 317; Significance: 1e-179; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 317; E-Value: 1e-179
Query Start/End: Original strand, 19 - 339
Target Start/End: Original strand, 7892086 - 7892406
Alignment:
| Q |
19 |
atgcaatggaggttgagaagggcaagacatatctgctaagaatcatcaatgcagcccttaatgatgagcttttcttttcccttgctggtcacaacatgac |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7892086 |
atgcaatggaggttgagaagggcaagacatatctgctaagaatcatcaatgcagcccttaatgatgagcttttcttttcccttgctggtcacaacatgac |
7892185 |
T |
 |
| Q |
119 |
agtagttgaagttgatgcagtttacacaaaaccattcacaacacaatccattctaattggtcctggtcaaaccacaaatgttctagtcaaagcaaacaaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7892186 |
agtagttgaagttgatgcagtttacacaaaaccattcacaacacaatccattctaattggtcctggtcaaaccacaaatgttctagtcaaagcaaacaaa |
7892285 |
T |
 |
| Q |
219 |
attccaagcagatacttcgttgctacaagaactttcatggatgcaccactctcagttgataacaaaaccgctacggctatattccaatacaaaggaattc |
318 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7892286 |
attccaagcagatacttcattgctacaagaactttcatggatgcaccactctcagttgataacaaaaccgctacggctatattccaatacaaaggaattc |
7892385 |
T |
 |
| Q |
319 |
caaacactatcatcccttcat |
339 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
7892386 |
caaacactatcatcccttcat |
7892406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 20 - 202
Target Start/End: Original strand, 7902360 - 7902542
Alignment:
| Q |
20 |
tgcaatggaggttgagaagggcaagacatatctgctaagaatcatcaatgcagcccttaatgatgagcttttcttttcccttgctggtcacaacatgaca |
119 |
Q |
| |
|
|||||||||||| || | || |||||||| || | |||||| |||| || ||||| || ||||||||||||||| || |||| ||||||||||||||| |
|
|
| T |
7902360 |
tgcaatggaggtagaacaagggaagacatacctcatgagaatcgtcaacgctgccctcaacgatgagcttttctttgccattgcgggtcacaacatgaca |
7902459 |
T |
 |
| Q |
120 |
gtagttgaagttgatgcagtttacacaaaaccattcacaacacaatccattctaattggtcctggtcaaaccacaaatgttct |
202 |
Q |
| |
|
||||| || |||||||| ||||| |||||||||||||| || || | || ||||||| |||||||||||||||||| ||||| |
|
|
| T |
7902460 |
gtagtggaggttgatgctgtttatacaaaaccattcaccactcaggctatactaattgctcctggtcaaaccacaaacgttct |
7902542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University