View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20138_low_14 (Length: 261)
Name: NF20138_low_14
Description: NF20138
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20138_low_14 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 93; Significance: 2e-45; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 120 - 245
Target Start/End: Original strand, 15584519 - 15584644
Alignment:
| Q |
120 |
tcccttgttatcaatacacaaaattgaaagaaagcaaagaaattcctactgaacagcgaaagaattttctgggtatttgcgagcgnnnnnnntgtacaca |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||| | |||||||| |
|
|
| T |
15584519 |
tcccttgttatcaatacacaaaattgaaagaaagcaaagaaattcctaatgaacagagaaagaattttctgggtatttgcgagagaaaaaaatgtacaca |
15584618 |
T |
|
| Q |
220 |
ccgaaatattctggataggatatatg |
245 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
15584619 |
ccgaaatattctggataggatatatg |
15584644 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 66 - 172
Target Start/End: Original strand, 15581513 - 15581619
Alignment:
| Q |
66 |
gtttgatcatatttaccaccatgtgcgtagtgaagttattcattatattgtgtttcccttgttatcaatacacaaaattgaaagaaagcaaagaaattcc |
165 |
Q |
| |
|
|||||||||| ||||||||||||| ||| ||||| ||||| ||||| |||||||||||| || |||||||||||||||||||||| |||| |||||||| |
|
|
| T |
15581513 |
gtttgatcatttttaccaccatgttcgtggtgaaattatttattatcctgtgtttcccttcttgtcaatacacaaaattgaaagaatgcaatgaaattcc |
15581612 |
T |
|
| Q |
166 |
tactgaa |
172 |
Q |
| |
|
|| |||| |
|
|
| T |
15581613 |
taatgaa |
15581619 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 27 - 64
Target Start/End: Original strand, 15584487 - 15584524
Alignment:
| Q |
27 |
aaagaaccatttgaagagatttcggtgcagtatccctt |
64 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15584487 |
aaagaaccatttgaagagatttcggtgcagtatccctt |
15584524 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University