View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20138_low_17 (Length: 239)
Name: NF20138_low_17
Description: NF20138
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20138_low_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 129; Significance: 7e-67; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 12 - 151
Target Start/End: Complemental strand, 37286101 - 37285961
Alignment:
| Q |
12 |
attattctagtggtccatggaaggattgtagtaagaggatatggtatgaaatcatctccagttt-cacaacttcataaaacttgcttactttgttttgtt |
110 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
37286101 |
attatcctagtggtccatggaaggattgtagtaagaggatatggtatgaaatcatctccagttttcacaacttcataaaacttgcttactttgttttgtt |
37286002 |
T |
 |
| Q |
111 |
gtcttcagcttcactttactaagtttatctacttcattggt |
151 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37286001 |
gtcttcagcttcactttactaagtttatctacttcattggt |
37285961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 151 - 220
Target Start/End: Complemental strand, 37285932 - 37285863
Alignment:
| Q |
151 |
tataggaaaatacgtgatgaaatgaaagagcttgtgtttgtgttgttgtgactactaactaactatagaa |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37285932 |
tataggaaaatacgtgatgaaatgaaagagcttgtgtttgtgttgttgtgactactaactaactatagaa |
37285863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University