View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20138_low_20 (Length: 208)
Name: NF20138_low_20
Description: NF20138
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20138_low_20 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 178; Significance: 3e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 3 - 188
Target Start/End: Original strand, 11018391 - 11018576
Alignment:
| Q |
3 |
ggggaacctactaacaatgacttattaggcatacttttggaatcaaattataaggaatctgaaaaaggtaatggtggtggaggaatgagtttaagggatg |
102 |
Q |
| |
|
|||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11018391 |
ggggaacctactaataatgacctattaggcatacttttggaatcaaattataaggaatctgaaaaaggtaatggtggtggaggaatgagtttaagggatg |
11018490 |
T |
|
| Q |
103 |
tagttgatgaggtgaagctgttttatctggcagggcaagaagcaaatgcagaattgcttgtttggactttattgttacttgccaag |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11018491 |
tagttgatgaggtgaagctgttttatctggcagggcaagaagcaaatgcagaattgcttgtttggactttattgttacttgccaag |
11018576 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University