View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20138_low_22 (Length: 206)
Name: NF20138_low_22
Description: NF20138
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20138_low_22 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 159; Significance: 7e-85; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 11 - 189
Target Start/End: Complemental strand, 51116060 - 51115882
Alignment:
| Q |
11 |
tgagatgaaggtcatggagaaggttcaccctcaacaatcgatatcgttgtcttccactggtgaagttgctgaaaacagtctccgaaatgatgtgtacact |
110 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
51116060 |
tgagatcaaggtcatggagaaggttcaccctcaacaatcgatatcgttgtcttccaccggtgaagttgctgaagacagtctccgaaatgatgtgtacact |
51115961 |
T |
 |
| Q |
111 |
gcagctgcttatggagatttggagaagctgcgtagattggtggagcaagagggttgccttgttaccgagcctgatggtt |
189 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
51115960 |
gcggctgcttatggagatttggagaagctgcgtagattggtggagcaagagggttgcctcgttaccgagcctgatggtt |
51115882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 67 - 186
Target Start/End: Complemental strand, 51106668 - 51106549
Alignment:
| Q |
67 |
ctggtgaagttgctgaaaacagtctccgaaatgatgtgtacactgcagctgcttatggagatttggagaagctgcgtagattggtggagcaagagggttg |
166 |
Q |
| |
|
|||||| ||| |||||| |||| |||| || ||||| |||| ||| ||||||||| ||||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
51106668 |
ctggtggagtcgctgaagacagactccagaaggatgtttacattgcgactgcttatgaggatttagagaagctacgtagattggtggagcaagagggttg |
51106569 |
T |
 |
| Q |
167 |
ccttgttaccgagcctgatg |
186 |
Q |
| |
|
||| |||||||||||||||| |
|
|
| T |
51106568 |
cctcgttaccgagcctgatg |
51106549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 102 - 189
Target Start/End: Original strand, 48032818 - 48032905
Alignment:
| Q |
102 |
gtgtacactgcagctgcttatggagatttggagaagctgcgtagattggtggagcaagagggttgccttgttaccgagcctgatggtt |
189 |
Q |
| |
|
||||||||||| || |||||||| |||||||||||||| | ||||||||||||| || ||||| ||||||| |||||||||||||| |
|
|
| T |
48032818 |
gtgtacactgccgcggcttatggggatttggagaagctacatagattggtggagattgaaggttgtcttgttaacgagcctgatggtt |
48032905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University