View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20138_low_22 (Length: 206)

Name: NF20138_low_22
Description: NF20138
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20138_low_22
NF20138_low_22
[»] chr1 (2 HSPs)
chr1 (11-189)||(51115882-51116060)
chr1 (67-186)||(51106549-51106668)
[»] chr4 (1 HSPs)
chr4 (102-189)||(48032818-48032905)


Alignment Details
Target: chr1 (Bit Score: 159; Significance: 7e-85; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 11 - 189
Target Start/End: Complemental strand, 51116060 - 51115882
Alignment:
11 tgagatgaaggtcatggagaaggttcaccctcaacaatcgatatcgttgtcttccactggtgaagttgctgaaaacagtctccgaaatgatgtgtacact 110  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||    
51116060 tgagatcaaggtcatggagaaggttcaccctcaacaatcgatatcgttgtcttccaccggtgaagttgctgaagacagtctccgaaatgatgtgtacact 51115961  T
111 gcagctgcttatggagatttggagaagctgcgtagattggtggagcaagagggttgccttgttaccgagcctgatggtt 189  Q
    || |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
51115960 gcggctgcttatggagatttggagaagctgcgtagattggtggagcaagagggttgcctcgttaccgagcctgatggtt 51115882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 67 - 186
Target Start/End: Complemental strand, 51106668 - 51106549
Alignment:
67 ctggtgaagttgctgaaaacagtctccgaaatgatgtgtacactgcagctgcttatggagatttggagaagctgcgtagattggtggagcaagagggttg 166  Q
    |||||| ||| |||||| |||| ||||  || ||||| |||| |||  |||||||||  ||||| |||||||| ||||||||||||||||||||||||||    
51106668 ctggtggagtcgctgaagacagactccagaaggatgtttacattgcgactgcttatgaggatttagagaagctacgtagattggtggagcaagagggttg 51106569  T
167 ccttgttaccgagcctgatg 186  Q
    ||| ||||||||||||||||    
51106568 cctcgttaccgagcctgatg 51106549  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 102 - 189
Target Start/End: Original strand, 48032818 - 48032905
Alignment:
102 gtgtacactgcagctgcttatggagatttggagaagctgcgtagattggtggagcaagagggttgccttgttaccgagcctgatggtt 189  Q
    ||||||||||| || |||||||| |||||||||||||| | |||||||||||||   || ||||| ||||||| ||||||||||||||    
48032818 gtgtacactgccgcggcttatggggatttggagaagctacatagattggtggagattgaaggttgtcttgttaacgagcctgatggtt 48032905  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University