View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20139_high_4 (Length: 269)
Name: NF20139_high_4
Description: NF20139
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20139_high_4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 103; Significance: 3e-51; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 147 - 253
Target Start/End: Original strand, 52626206 - 52626312
Alignment:
| Q |
147 |
actcttcatttctacggtcgttagctaataaataactcaaccttgtccatcattttcctttccaaacatcaacaactcgattatgttgtccttagttgaa |
246 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52626206 |
actcttcatttctacggtccttagctaataaataactcaaccttgtccatcattttcctttccaaacatcaacaactcgattatgttgtccttagttgaa |
52626305 |
T |
|
| Q |
247 |
catattt |
253 |
Q |
| |
|
||||||| |
|
|
| T |
52626306 |
catattt |
52626312 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University