View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20139_high_7 (Length: 212)
Name: NF20139_high_7
Description: NF20139
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20139_high_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 152; Significance: 1e-80; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 46 - 197
Target Start/End: Complemental strand, 37305610 - 37305459
Alignment:
| Q |
46 |
catgaatacatcagccagcatcaaatgcttgtgataatatttacatatcacataatagggtcttaaataaactatgaaagtaatagggtcaaacaagata |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37305610 |
catgaatacatcagccagcatcaaatgcttgtgataatatttacatatcacataatagggtcttaaataaactatgaaagtaatagggtcaaacaagata |
37305511 |
T |
|
| Q |
146 |
ttttaaatagataccattcattatttgctaaagcatcaagaagagttgactt |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37305510 |
ttttaaatagataccattcattatttgctaaagcatcaagaagagttgactt |
37305459 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 16 - 47
Target Start/End: Complemental strand, 37305678 - 37305647
Alignment:
| Q |
16 |
aatatattttaaggtgatattattaggtgaca |
47 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
37305678 |
aatatattttaaggtgatattattaggtgaca |
37305647 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University