View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20139_low_6 (Length: 282)
Name: NF20139_low_6
Description: NF20139
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20139_low_6 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 19 - 282
Target Start/End: Complemental strand, 37305918 - 37305655
Alignment:
| Q |
19 |
cataggatttaggttttgcggtgttacaaccttgtcaatgcatgtagttagctatatctagattgtctcgagacaatctatatttcaaagtcagtatttt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
37305918 |
cataggatttaggttttgcggtgttacatcctcgtcaatgcatgtagttagctatatctagattgtcccgagacaatctatatttcaaggtcagtatttt |
37305819 |
T |
|
| Q |
119 |
aaatttaaacaaataaaattattgaaatttgaatcgttcgatcttgattgaatggtatagacttgactgattgtgcgcagacacattgcacaaaatctaa |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| | |
|
|
| T |
37305818 |
aaatttaaacaaataaaattattgaaatttgaatcgttcgatcttgattgaatggtatagacttgactgattgtgcgcagacaaattgcacaaaatctga |
37305719 |
T |
|
| Q |
219 |
atcatcgttattgggcagaataataacaatcatgtacaaaaatatattttaaggtgatattatt |
282 |
Q |
| |
|
|||||||| |||| ||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
37305718 |
atcatcgtcattgaccagaataataacaatcaggtacaaaaatatattttaaggtgatattatt |
37305655 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University