View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2013_high_20 (Length: 323)
Name: NF2013_high_20
Description: NF2013
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2013_high_20 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 108; Significance: 3e-54; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 193 - 300
Target Start/End: Original strand, 4840222 - 4840329
Alignment:
| Q |
193 |
tgatcatgagaatagagtgaatagtagatttgttcccctaagatatgtcataccatcttcataccccgtctgttgttgtatttatttaggcaggtagtgg |
292 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4840222 |
tgatcatgagaatagagtgaatagtagatttgttcccctaagatatgtcataccatcttcataccccgtctgttgttgtatttatttaggcaggtagtgg |
4840321 |
T |
 |
| Q |
293 |
acacggcc |
300 |
Q |
| |
|
|||||||| |
|
|
| T |
4840322 |
acacggcc |
4840329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 19 - 112
Target Start/End: Original strand, 4840048 - 4840141
Alignment:
| Q |
19 |
ttttagtcatgagttaatgccaatattatcatatttgtcttcttagcaaatgactcgttagaattttcctaattttaaacaataaccgtgtgag |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
4840048 |
ttttagtcatgagttaatgccaatattatcatatttgtcttcttagcaaatgactcattagaattttcctaattttaaacaataaacgtatgag |
4840141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University