View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2013_high_27 (Length: 290)
Name: NF2013_high_27
Description: NF2013
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2013_high_27 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 18 - 290
Target Start/End: Complemental strand, 44226919 - 44226647
Alignment:
| Q |
18 |
caaagtggtggtggttcttccaccatctacccccttatggggtttccttcgtcggcgccaccgcgacttcttttgcttcgccgaagctgctcgctgtagt |
117 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
44226919 |
caaagtggtggtggttcttccaccacctacccccttatggggtttccttcgtcggcgccgccgcgacttcttttgcttcgccaaagctgctcgccgtagt |
44226820 |
T |
|
| Q |
118 |
cgcttggacggtttatggatcgctggtggtgttagtggattgtcggttctttagttgccggcattcagtttgggttttcttgttcatatccatatatgtg |
217 |
Q |
| |
|
| || || |||||||||||||||||||||||||||||||||| || |||||| |||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
44226819 |
cactcgggcggtttatggatcgctggtggtgttagtggattgccgattcttttattgccggcattctgtttgggttttcttgttcatatccatatatgtg |
44226720 |
T |
|
| Q |
218 |
ttggtgggttatgctcgcagctggcctccaccattttggaaggtttatgtttttgttttacaatggcggattc |
290 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
44226719 |
ttggtgggttatgctcgcagattgcctccaccattttggaaggttcgtgtttttgttttacaatcgcggattc |
44226647 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 206 - 286
Target Start/End: Complemental strand, 2508807 - 2508729
Alignment:
| Q |
206 |
tccatatatgtgttggtgggttatgctcgcagctggcctccaccattttggaaggtttatgtttttgttttacaatggcgg |
286 |
Q |
| |
|
|||| ||||||||||||||||| ||| |||| ||||||||| ||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
2508807 |
tccagatatgtgttggtgggttt--ctcatagcttgcctccaccgttttggaaggtttgtgtttttgttttacaatcgcgg |
2508729 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University