View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2013_high_29 (Length: 265)
Name: NF2013_high_29
Description: NF2013
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2013_high_29 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 1 - 157
Target Start/End: Original strand, 29189767 - 29189923
Alignment:
| Q |
1 |
tatttatttagtcttgtgaccatagaagaacacttctaagtttatatgttggaagttggtcaaaggagagtaaagaatcacgagtacttatgattaaaaa |
100 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29189767 |
tatttatttagtcttgtgatcatagaagaatacttctaagtttatatgttgggagttggtcaaaggagagtaaagaatcacgagtacttatgattaaaaa |
29189866 |
T |
|
| Q |
101 |
tacacatatattgacttaaaaacaatgaatgttgactgaggaccattgtttgaagga |
157 |
Q |
| |
|
|| | || ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29189867 |
tataaatgtattgacttaaaaacaatgaatgttgactgaggaccattgtttgaagga |
29189923 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University