View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2013_high_37 (Length: 211)

Name: NF2013_high_37
Description: NF2013
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2013_high_37
NF2013_high_37
[»] chr7 (1 HSPs)
chr7 (1-201)||(21091782-21091982)


Alignment Details
Target: chr7 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 201
Target Start/End: Complemental strand, 21091982 - 21091782
Alignment:
1 tacttacatatgcaattcattgtttgtggtgttgattccaattgttgaaattgggaggtatttggaggattcttatggaagtttattgttttggaagagt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
21091982 tacttacatatgcaattcattgtttgtggtgttgattccaattgttgaaattgggaggtatttggaggattcttatggaagtttattgttttggaagagt 21091883  T
101 gataagagtttaaaagggaggttaggggagtcggagcaggcgatacttcttagagataatgaggcgagcggtgaagttgtggagtcgttggttattgatg 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
21091882 gataagagtttaaaagggaggttaggggagtcggagcaggcgatacttcttagagataatgaggcaagcggtgaagttgtggagtcgttggttattgatg 21091783  T
201 a 201  Q
    |    
21091782 a 21091782  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University