View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2013_low_10 (Length: 434)
Name: NF2013_low_10
Description: NF2013
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2013_low_10 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 302; Significance: 1e-170; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 96 - 420
Target Start/End: Complemental strand, 27134181 - 27133856
Alignment:
| Q |
96 |
gtggaggaaagccagcataacgtgtcgttgatgaagcagaagaggaaaacaaatgtgcaaagttacaaaaatcccaattatagtcataaatcatacattt |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27134181 |
gtggaggaaagccagcataacgtgtcgttgatgaagcagaagaggaaaacaaatgtgcaaagttacaaaaatcccaattatagtcataaatcatacattt |
27134082 |
T |
|
| Q |
196 |
atgttttcctatgctcataacgtaagcaagtttcggtgggggtgtatgtgtgaatgcttctgcactaatattaataccctaccttaggtgtcacacaata |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27134081 |
atgttttcctatgctcataacgtaagcaagtttcggtgggggtgtatgtgtgaatgcttctgcactaatattaataccctaccttaggtgtcacacaata |
27133982 |
T |
|
| Q |
296 |
cgcattctagtcctatctctctttcaagggcaccctcaaatcaaattggtgact-attatccacaatctcttttgctttctgttcactcatagaaacaaa |
394 |
Q |
| |
|
||||||||||| |||||||||||||||||| ||||||||||||||||||||||| | ||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
27133981 |
cgcattctagtactatctctctttcaaggggaccctcaaatcaaattggtgactaagtatccacaatctcttttgctttctgttcattcatagaaacaaa |
27133882 |
T |
|
| Q |
395 |
aaggtgactgttccattgatatatat |
420 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
27133881 |
aaggtgactgttccattgatatatat |
27133856 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 3 - 43
Target Start/End: Complemental strand, 27134274 - 27134234
Alignment:
| Q |
3 |
gatcaaaactgccgaattttaaaataggaagttaattctac |
43 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
27134274 |
gatcaaaactgccaaattttaaaataggaagttaattctac |
27134234 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University