View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2013_low_35 (Length: 234)
Name: NF2013_low_35
Description: NF2013
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2013_low_35 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 30 - 220
Target Start/End: Complemental strand, 13771820 - 13771619
Alignment:
| Q |
30 |
acggttcaattttttgtagaaaatagaggtaacatggtaaatgattattagtacagaactttttgctaaaacattgaagaaatatactatagacaaaaca |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13771820 |
acggttcaattttttgtagaaaatagaggtaacatggtaaatgattattagtacagaacttcttgctaaaacattgaagaaatatactatagacaaaaca |
13771721 |
T |
 |
| Q |
130 |
tagttcatgtaacatatggtaaatgcatatgtccattatcaatag-----------tactcatagccacaggtgcttaaaaaatgtcctaatagtagtat |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
13771720 |
tagttcatgtaacatatggtaaatgcatatgtccattatcaatagtactatagtagtactcatagccacaggtgcttacaaaatgtcctaatagtagtat |
13771621 |
T |
 |
| Q |
219 |
tt |
220 |
Q |
| |
|
|| |
|
|
| T |
13771620 |
tt |
13771619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University