View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20140_high_16 (Length: 236)
Name: NF20140_high_16
Description: NF20140
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20140_high_16 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 139; Significance: 7e-73; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 1 - 139
Target Start/End: Complemental strand, 36563805 - 36563667
Alignment:
| Q |
1 |
aaagtttggttggagtttttaatgaccagtttgtatgtggtttttattgtttcttctaggtatgactataaacatttaatttcttgtcaatgtctcatcg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36563805 |
aaagtttggttggagtttttaatgaccagtttgtatgtggtttttattgtttcttctaggtatgactataaacatttaatttcttgtcaatgtctcatcg |
36563706 |
T |
|
| Q |
101 |
cccttcaccattttttaaggtatgaaatgttatgaaata |
139 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36563705 |
cccttcaccattttttaaggtatgaaatgttatgaaata |
36563667 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 138 - 222
Target Start/End: Complemental strand, 36563539 - 36563455
Alignment:
| Q |
138 |
tatgatttaatagataagttaaattagttttacatattctccctaccagatggcatacttttacattgaatcttttctctcacat |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
36563539 |
tatgatttaatagataagttaaattagttttaaatattctccctaccagatgacatacttttacattgaatcttttctctcacat |
36563455 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University