View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20140_high_8 (Length: 304)
Name: NF20140_high_8
Description: NF20140
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20140_high_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 252; Significance: 1e-140; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 1 - 268
Target Start/End: Original strand, 29269548 - 29269815
Alignment:
| Q |
1 |
aacctcttaggactttttagcacccacttatttgttcaattgatgcctttgattgtttgaattattgtcacttgataatgttcattgtattgtgtgacat |
100 |
Q |
| |
|
|||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29269548 |
aaccacttaggactttttagcccccacttatttgttcaattgatgcctttgattgtttgaattattgtcacttgataatgttcattgtattgtgtgacat |
29269647 |
T |
 |
| Q |
101 |
tgttcatcatatatgcgacattgttcatcgtactattgacactatttactattgagttgtatcgtttatctcagtatgttacttgcacatggttaggagg |
200 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29269648 |
tgttcatcatatatgcgacaatgttcatcgtactattgacactatttactattgagttgtatcgtttatctcagtatgttacttgcacatggttaggagg |
29269747 |
T |
 |
| Q |
201 |
aacatggtttgtggtgcacatgaattgtatgatgacgtgcttgaaagaggaatttatggcgattggaa |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
29269748 |
aacatggtttgtggtgcacatgaattgtatgatgaggtgcttgaaagaggaatttatggcgattggaa |
29269815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 189 - 265
Target Start/End: Original strand, 29271929 - 29272005
Alignment:
| Q |
189 |
atggttaggaggaacatggtttgtggtgcacatgaattgtatgatgacgtgcttgaaagaggaatttatggcgattg |
265 |
Q |
| |
|
|||||||||||||| |||||||||| ||||| | || |||||||||| || |||| ||||| |||||||| ||||| |
|
|
| T |
29271929 |
atggttaggaggaatatggtttgtgatgcacgtcaactgtatgatgaaatggttgagagagggatttatggtgattg |
29272005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University