View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20140_low_10 (Length: 288)
Name: NF20140_low_10
Description: NF20140
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20140_low_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 12 - 248
Target Start/End: Original strand, 26049846 - 26050081
Alignment:
| Q |
12 |
gattattctgaatcaataacaaaatcaacgttattaagatgtaagtcatggaactattagaaagcatgaaataggtttggggcttccactaaatccatat |
111 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
26049846 |
gatttttctgaatcaataacaaaatcaacgttatcaagatgtaagtcgtggaactattagaaagcatgaaataggtttggagcttccactaaatccatat |
26049945 |
T |
 |
| Q |
112 |
tacaaacaggtgatgctcagatagtcttggcaagaataaatgcactttcatcatctctaataaatatactaattccaatacgattttgttgcgatgaaaa |
211 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
26049946 |
tacaaacaggtgatgcccagatggtcttggcaagaacaaatgcactttcatcatctctaataaatatactaatttcaatacgattttgttgcgatgaaaa |
26050045 |
T |
 |
| Q |
212 |
tgatgcatcaaatattacaattgcatctacctcttta |
248 |
Q |
| |
|
| ||||||| ||| |||||||||| | ||| |||||| |
|
|
| T |
26050046 |
ttatgcatc-aatgttacaattgcttatacatcttta |
26050081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University