View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20140_low_12 (Length: 276)
Name: NF20140_low_12
Description: NF20140
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20140_low_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 93; Significance: 2e-45; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 1 - 93
Target Start/End: Original strand, 51252850 - 51252942
Alignment:
| Q |
1 |
ctgcactttgtcctggtcaagatgaatgctctcttgccatttacctctctggtttccaacaagttgtgagtgttcatctcttttctaccatct |
93 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51252850 |
ctgcactttgtcctggtcaagatgaatgctctcttgccatttacctctctggtttccaacaagttgtgagtgttcatctcttttctaccatct |
51252942 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 164 - 239
Target Start/End: Original strand, 51253079 - 51253154
Alignment:
| Q |
164 |
ggttctcaccattttctgggtacaatgctcttctcataaaaacaactgtctagcagctacaataacgcttcttttc |
239 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51253079 |
ggttgtcaccattttctgggtacaatgctcttctcataaaaacaactgtctagcagctacaataacgcttcttttc |
51253154 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 121 - 152
Target Start/End: Original strand, 51252995 - 51253026
Alignment:
| Q |
121 |
ttccgacaccaacatatatgattatattttat |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
51252995 |
ttccgacaccaacatatatgattatattttat |
51253026 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University