View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20140_low_13 (Length: 257)
Name: NF20140_low_13
Description: NF20140
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20140_low_13 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 18 - 257
Target Start/End: Original strand, 31008990 - 31009229
Alignment:
| Q |
18 |
ttattatttacttactatattagcattttcaaaaccttaacttagatcacaccacatcctcttataattgccacaaacaaaacataacatacaaatattt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31008990 |
ttattatttacttactatattagcattttcaaaaccttaacttaggtcacaccacatcctcttataattgccacaaacaaaacataacatacaaatattt |
31009089 |
T |
|
| Q |
118 |
acctcaatttggctccatctgcattttgttgttgcttcttctgcaatcaacaaccaatctccatctgcaggagaagcacacaacacaaaaatggggtatg |
217 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||| ||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
31009090 |
acctcaatttggctccatctgaattttgttgttgcttcttctgcaatcaacaatcaatctacatctgcagaagaagcacacaacacaaaaatggggtatg |
31009189 |
T |
|
| Q |
218 |
tagaaacaacctcatcacaactacacacccctcttctttc |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31009190 |
tagaaacaacctcatcacaactacacacccctcttctttc |
31009229 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University