View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20140_low_15 (Length: 250)
Name: NF20140_low_15
Description: NF20140
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20140_low_15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 35 - 242
Target Start/End: Original strand, 42975454 - 42975661
Alignment:
| Q |
35 |
aaagaactttcttattatcttagtgaagttttaatttttgatttcatataagaaaaaattcttctgaaattttccgcgtatagtttttcccccagttatc |
134 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42975454 |
aaagaactctcttattatcttagtgaagttttaattttcgatttaatataagaaaaaattcttctgaaattttccgcgtatagtttttcccccagttatc |
42975553 |
T |
|
| Q |
135 |
ggttaaatttaatatattagtttttagatgtagtttattcattcttctttatatttggccaattggccccctcgtaaaatttatgttagctccgtcattg |
234 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
42975554 |
ggttaaacttaatatattagtttttagatgtagtttattcattcttctttatatttggccaattggccccctcgtaaaatttatgttagctccatcattg |
42975653 |
T |
|
| Q |
235 |
tctgtgct |
242 |
Q |
| |
|
|||||||| |
|
|
| T |
42975654 |
tctgtgct |
42975661 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University