View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20142_high_15 (Length: 233)
Name: NF20142_high_15
Description: NF20142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20142_high_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 18 - 223
Target Start/End: Original strand, 45993113 - 45993313
Alignment:
| Q |
18 |
ccattatttttccacatatcttttgttaaatatttaaccttactccttgaactcacaatacatttggacttcctcaagaaacgcatatgctcaattaaag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
45993113 |
ccattatttttccacatatcttttgttaaatatttaaccttactccttgaactcacaatacatttggacttcctcaagaaacgcatatgctc-----aag |
45993207 |
T |
 |
| Q |
118 |
tccttgttttcttgactcatgattttcggaacacaacaagatcatatcatacatgtatatatatggcctccttgtgacctttttcagcagcaatctttca |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||| || ||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
45993208 |
tccttgttttcttgactcatgattttcggaacacaacaagatcataccatacatacatgtatatggcctccttgtgacctttttcagcagcaatctttaa |
45993307 |
T |
 |
| Q |
218 |
tctctc |
223 |
Q |
| |
|
|||||| |
|
|
| T |
45993308 |
tctctc |
45993313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University