View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20142_high_16 (Length: 227)
Name: NF20142_high_16
Description: NF20142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20142_high_16 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 123; Significance: 2e-63; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 1 - 131
Target Start/End: Complemental strand, 13371901 - 13371771
Alignment:
| Q |
1 |
tgcaaataagagtaaatattagtttgacaaaacacaaggatggtttaaccaatcacagatcacagccctatcccgaggtagacaggcatatgctttatca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13371901 |
tgcaaataagagtaaatattagtttgacaaaacacaaggatggtttaaccaatcacagatcacagccctatcccgaggtagacaggcatatgctttatca |
13371802 |
T |
|
| Q |
101 |
gaatggatcgtcaacggtgaagccggctgta |
131 |
Q |
| |
|
||||||||||| ||||||| ||||||||||| |
|
|
| T |
13371801 |
gaatggatcgttaacggtgcagccggctgta |
13371771 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 171 - 227
Target Start/End: Complemental strand, 13371765 - 13371709
Alignment:
| Q |
171 |
acagtctgcatttggctgcaccgtataatcgagtgtagcggatcaacgtccgtgctt |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13371765 |
acagtctgcatttggctgcaccgtataatcgagtgtagcggatcaacgtccgtgctt |
13371709 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University