View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20142_low_20 (Length: 229)
Name: NF20142_low_20
Description: NF20142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20142_low_20 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 87; Significance: 7e-42; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 13 - 107
Target Start/End: Complemental strand, 29791372 - 29791279
Alignment:
| Q |
13 |
aaaataatattgaaaattagaatataaaaacaaaataattgactctaattaatttgtttctaagtgctccggacgtcaaaattaaaagttaattc |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29791372 |
aaaataatattgaaaattagaatataaaaacaaaata-ttgactctaattaatttgtttctaagtgctccggacgtcaaaattaaaagttaattc |
29791279 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 151 - 214
Target Start/End: Complemental strand, 29791235 - 29791172
Alignment:
| Q |
151 |
gtgaaaaaattcagcgcgatgtaaactaggtacgtcagtccccataagcttaactcaaccattc |
214 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
29791235 |
gtgagaaaattcagcgcgatgtaaactaggtacgtcagtccccatgaacttaactcaaccattc |
29791172 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University