View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20142_low_22 (Length: 217)

Name: NF20142_low_22
Description: NF20142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20142_low_22
NF20142_low_22
[»] chr2 (2 HSPs)
chr2 (19-199)||(12616157-12616337)
chr2 (49-101)||(29878072-29878124)


Alignment Details
Target: chr2 (Bit Score: 173; Significance: 3e-93; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 19 - 199
Target Start/End: Complemental strand, 12616337 - 12616157
Alignment:
19 ctatcagctgaaaaatcaatggtaataaaactcatagtaaaagcttgtgaagaatatggtttcttcaatgtgattaaccatggtgtcccttatgacatca 118  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
12616337 ctatcagctgaaaaatcaatggtaataaaactcatagtaaaagcttgtgaagaatatggtttcttcaatgtgattaaccatggtgtccctcatgacatca 12616238  T
119 tatccaaaatggaagaagtaggttttgatttctttgcaaaaccaatggaacaaaagaaactagttgcacctggtaatccct 199  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
12616237 tatccaaaatggaagaagtaggttttgatttctttgcaaaaccaatggaacaaaagaaactagttgcacttggtaatccct 12616157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 49 - 101
Target Start/End: Complemental strand, 29878124 - 29878072
Alignment:
49 ctcatagtaaaagcttgtgaagaatatggtttcttcaatgtgattaaccatgg 101  Q
    ||||||||||||||||||||||| | ||| |||||||| || || ||||||||    
29878124 ctcatagtaaaagcttgtgaagattttggattcttcaaagtcataaaccatgg 29878072  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University