View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20142_low_22 (Length: 217)
Name: NF20142_low_22
Description: NF20142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20142_low_22 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 173; Significance: 3e-93; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 19 - 199
Target Start/End: Complemental strand, 12616337 - 12616157
Alignment:
| Q |
19 |
ctatcagctgaaaaatcaatggtaataaaactcatagtaaaagcttgtgaagaatatggtttcttcaatgtgattaaccatggtgtcccttatgacatca |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
12616337 |
ctatcagctgaaaaatcaatggtaataaaactcatagtaaaagcttgtgaagaatatggtttcttcaatgtgattaaccatggtgtccctcatgacatca |
12616238 |
T |
|
| Q |
119 |
tatccaaaatggaagaagtaggttttgatttctttgcaaaaccaatggaacaaaagaaactagttgcacctggtaatccct |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
12616237 |
tatccaaaatggaagaagtaggttttgatttctttgcaaaaccaatggaacaaaagaaactagttgcacttggtaatccct |
12616157 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 49 - 101
Target Start/End: Complemental strand, 29878124 - 29878072
Alignment:
| Q |
49 |
ctcatagtaaaagcttgtgaagaatatggtttcttcaatgtgattaaccatgg |
101 |
Q |
| |
|
||||||||||||||||||||||| | ||| |||||||| || || |||||||| |
|
|
| T |
29878124 |
ctcatagtaaaagcttgtgaagattttggattcttcaaagtcataaaccatgg |
29878072 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University