View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20142_low_24 (Length: 208)
Name: NF20142_low_24
Description: NF20142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20142_low_24 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 158; Significance: 3e-84; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 17 - 190
Target Start/End: Complemental strand, 7883647 - 7883475
Alignment:
| Q |
17 |
atatggggaagtccatttaccataccgtttgcattcactatgcacaagcttctaaagtttagatgcccgtatttgtgatgccatgtccagttttcactca |
116 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7883647 |
atatggggaagttcatttaccataccgtttgcattcattatgcacaagcttctaaagtttagatgcccgtatttgtgatgccatgtccagttttcactca |
7883548 |
T |
 |
| Q |
117 |
aaactgtagctgctaaacaatgatgattcaatacttcaatttctattttgaaggttctatttatggatagaggt |
190 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7883547 |
aaactgtagctgctaaacaatgatga-tcaatacttcaatttctattttgaaggttctatttatggatagaggt |
7883475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 17 - 190
Target Start/End: Complemental strand, 7898393 - 7898218
Alignment:
| Q |
17 |
atatggggaagtccatttaccataccgttt--gcattcactatgcacaagcttctaaagtttagatgcccgtatttgtgatgccatgtccagttttcact |
114 |
Q |
| |
|
|||||||||||||||||||||||||| ||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7898393 |
atatggggaagtccatttaccataccttttttgcattcattatgcacaagcttctaaagtttagatgcccgtatttgtgatgccatgtccagttttcact |
7898294 |
T |
 |
| Q |
115 |
caaaactgtagctgctaaacaatgatgattcaatacttcaatttctattttgaaggttctatttatggatagaggt |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7898293 |
caaaactgtagctgctaaacaatgatgattcaatacttcaatttctattttgaaggttctatttatggatagaggt |
7898218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University